[صفحه اصلی ]   [Archive] [ English ]  
:: صفحه اصلي :: درباره نشريه :: آخرين شماره :: تمام شماره‌ها :: جستجو :: ثبت نام :: ارسال مقاله :: تماس با ما ::
:: دوره 24، شماره 2 - ( دوماه نامه 1399 ) ::
جلد 24 شماره 2 صفحات 219-226 برگشت به فهرست نسخه ها
بررسی جهش‌های شایع در بیماران بتاتالاسمی در جمعیت‌های ایرانی با روش SNaPshot
سپیده مهرزاد ، زهرا کشتمند*
گروه زیست‌شناسی، واحد تهران مرکزی، دانشگاه آزاد اسلامی، تهران، ایران ، zkeshtmand2001@gmail.com
چکیده:   (100 مشاهده)
سابقه و هدف: بتاتالاسمی یکی از شایع‌ترین بیماری‌های ژنتیکی در ایران است و بیش از دو میلیون حامل بتاتالاسمی در ایران وجود دارد. شناسایی جهش‌های ژن بتاگلوبین برای برنامه‌ای تشخیصی و مدیریتی معین، مانند تشخیص پیش از زایمان بیماری بتاتالاسمی ضروری است. هدف از این مطالعه، بررسی جهش‌های شایع در بیماران بتاتالاسمی در جمعیت‌های ایرانی با روش SNaPshot  است.
مواد و روش‌ها: در این مطالعه‌ی توصیفی، از 20 بیمار آزمایشگاه ژنتیک پزشکی در تهران و اهواز که در طرح غربالگری ازدواج شناسایی شده بودند، پس از اخذ رضایت کتبی و تکمیل پرسشنامه، 10 سی‌سی نمونه خون وریدی همراه با ماده ضدّانعقاد EDTA جمع‌آوری شد. سپس برای استخراج DNA از روش boiling و برای تعیین جهش‌ها از روش SNaPshot استفاده شد. در نهایت داده‌ها با نرم‌افزار geen maper مورد آنالیز قرار گرفت.
نتایج: در این مطالعه، فراوانی جهش‌های شایع بتاتالاسمی نشان داد که جهش 1-IVS II به میزان 30 درصد شایع‌ترین و جهش‌های شایع دیگر جهش Fsc8-9 (20 درصد)، Fsc36-37 (15 درصد)، IVS I-5 (10 درصد) و IVS I-I (5 درصد) می‌باشد.
نتیجه‌گیری: نتایج حاصل از مطالعه نشان می‌دهد که تفاوت در شیوع، بین مطالعه حاضر و دیگر مطالعات می‌تواند به‌دلیل جامعه آماری پراکنده و تعداد کمتر نمونه‌های گرفته‌شده باشد. زیرا این مطالعه با تمرکز بیشتر بر روی کارآیی تکنیک SNaPshot در تشخیص جهش‌ها انجام شده است.
واژه‌های کلیدی: تالاسمی، SNaPshot، ژن بتاگلوبین
متن کامل [PDF 456 kb]   (7 دریافت)    
نوع مطالعه: پژوهشي | موضوع مقاله: medicine, paraclinic
دریافت: 1398/4/24 | پذیرش: 1399/2/16 | انتشار: 1399/2/10
فهرست منابع
1. Cappellini MD, Motta I. New therapeutic targets in transfusion-dependent and-independent thalassemia. Hematology Am Soc Hematol Educ Program 2017; 2017(1): 278-83.
2. Birgens H, Ljung R. The thalassaemia syndromes. Scand J Clin Lab Invest 2007; 67(1): 11-26.
3. Verma IC, Kleanthous M, Saxena R, Fucharoen S, Winichagoon P, Raizuddin S, et al. Multicenter study of the molecular basis of thalassemia intermedia in different ethnic populations. Inter J Hemo Res 2007; 31(4): 439-52.
4. Cousens NE, Gaff CL, Metcalfe SA, Delatycki MB. Carrier screening for beta-thalassaemia: a review of International practice. Eur J Hum Genet 2010; 18(10): 1077-83
5. Chinchang W, Viprakasit V, Pung-Amritt P, Tanphaichitr VS, Yenchitsomanus PT.Molecular analysis of unknown β-globin gene mutations using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) technique and its application in Thai families with β-thalassemias and β-globin variants. Clin Biochem 2005; 38(11): 987-96.
6. Chanpeng P, Svasti S, Paiboonsukwong K, Smith DR, Leecharoenkiat K. Platelet proteome reveals specific proteins associated with platelet activation and the hypercoagulable state in β-thalassmia/HbE patients. Sci Rep 2019; 9(1): 1-11.
7. Pooladi N, Hosseinpour Feizi MA, Haghi M, Azarfam P, Hosseinpour Feizi A. Analysis of beta thalassemia mutations using the single strand conformation polymorphism (SSCP) technique. J Kurdistan Univ Med Sc 2010; 15(3): 13-9. [in Persian]
8. Najmabadi H, Pourfathollah AA, Neishabury M, Sahebjam F, Krugluger W, Oberkanins C. Rare and unexpected mutations among Iranian beta-thalassemia patients and prenatal samples discovered by reverse-hybridization and DNA sequencing. Inter J Hemo Res 2002; 87(10): 1113-14.
9. Newton C, Graham A, Heptinstall L, Powell S, Summers C, Kalsheker N, et al. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res 1989; 17(7): 2503-16.
10. Budowle B, Van Daal AJB. Forensically relevant SNP classes. Biotechniques 2008; 44(5): 603-10.
11. Noveski P, Trivodalieva S, Efremov G, Plaseska-Karanfilska DJBJoMG. Y chromosome single nucleotide polymorphisms typing by SNaPshot minisequencing. BJMG 2010; 13(1): 9-16.
12. Madjunkova S, Volk M, Peterlin B, Plaseska-Karanfilska DJGt, biomarkers m. Detection of thrombophilic mutations related to spontaneous abortions by a multiplex SNaPshot method. Genet Test Mol Biomarkers 2012; 16(4): 259-64.
13. Galehdari H, Salehi B, Pedram M, M Oraki Kohshour. High prevalence of rare mutations in the Beta globin gene in an ethnic group in iran. Iran Red Cres Med J 2011; 13(5): 356.
14. Biljana A, Georgi I, Dijana PK, Lyubomira C .Efficient Detection of Mediterranean β-Thalassemia Mutations by Multiplex Single-Nucleotide Primer Extension PLoS One 2012; 7(10): e48167.
15. Boonchai B, Chalinee M, Chanchai T. Molecular analysis of beta-globin gene mutations among Thai beta-thalassemia children: results from a single center study. Appl Clin Genet 2014; 7: 253–58.
16. Verma IC, Saxena R, Thomas E, Jain PK. Regional distribution of β-thalassemia mutations in India. Hum Genet 1997; 100(1): 109-13.
17. Rizo-de-la-Torre LC, Ibarra B, Sánchez-López JY, Magaña-Torres MT, Rentería-López VM, Perea-Díaz FJ Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients. Int J Lab Hematol 2017; 39(5): 539-45.
18. Kelkar AJ, Moses A. Thalassemia intermedia phenotype resulting from rare combination of c.46delT [Codon15 (-T)] mutation of beta globin gene and HPFH3.Clin Case Rep 2017; 5(7): 1107-10.
19. Miri-Moghaddam E, Zadeh-Vakili A, Rouhani Z, Naderi M, Eshghi P, Khazaei Feizabad A. Molecular basis and prenatal diagnosis of β-thalassemia among Balouch population in Iran. Prenat Diagn 2011; 31(8): 788-91.
20. Ozkinay F, Onay H, Karaca E, Arslan E, Erturk B, Ece Solmaz A, et al. Molecular basis of β-thalassemia in the population of the Aegean region of Turkey: Identification of a novel deletion mutation. Inter J Hemo Res 2015; 39(4): 230-34.
21. Aristizabal A, Merino S, Catediano E, Sasieta M, Aragües P, Navajas A. Clinical consequences of alpha-thalassemia in the Basque Country, Spain. Impact of neonatal screening. Anales de Pediatría (English Edition) 2015; 83(2): 85-8.
22. Hosseinpour Feizi MA, Hosseinpour Feizi AA, Pouladi N, Haghi M, Azarfam PJH. Molecular spectrum of β-thalassemia mutations in Northwestern Iran. Inter J Hemo Res 2008; 32(3): 255-61.
23. Mohammad Asl J, Samarbafzadeh AR, Mak Vandi M, Zandian KHM, Pedram M. A report on prevalence of β thalassemia gene mutations in thalassemia patients from khuzestan province. J Birjand Univ Med Sc 2008; 6(4): 398-03. [in Persian]
24. Nejat M, Rabbani B. An overview of mutation detection methods in genetic disorders. Iran J Pediatr 2013; 23(4): 375-88.
25. Nikuei P, Hadavi V, Rajaei M, Saberi M, Hajizade F, Najmabadi HJH. Prenatal diagnosis for β-thalassemia major in the Iranian Province of Hormozgan. Iran J Ped Hematol Oncol 2008; 32(6): 539-45.
26. Rahimi Z, Muniz A, Parsian A. Detection of responsible mutations for beta thalassemia in the Kermanshah Province of Iran using PCR-based techniques. Mol Biol Rep 2010; 37(1): 149-54.
27. Sharifi A, Aminzadeh M, Pourmoghaddam Z, N Mahdieh. The frequency of common beta-thalassemia mutations among couples referred to health centers of Ilam during a five years period. J Ilam Univ Med Sc 2014; 22(2): 17-23. [in Persian]
ارسال پیام به نویسنده مسئول

ارسال نظر درباره این مقاله
نام کاربری یا پست الکترونیک شما:

CAPTCHA


XML   English Abstract   Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Mehrzad S, Keshtmand Z. Evaluation of common mutations in β-thalassemia patients in Iranian populations using SNaPshot method. Feyz. 2020; 24 (2) :219-226
URL: http://feyz.kaums.ac.ir/article-1-3927-fa.html

مهرزاد سپیده، کشتمند زهرا. بررسی جهش‌های شایع در بیماران بتاتالاسمی در جمعیت‌های ایرانی با روش SNaPshot. دوماه نامه علمي ـ پژوهشي فيض. 1399; 24 (2) :219-226

URL: http://feyz.kaums.ac.ir/article-1-3927-fa.html



دوره 24، شماره 2 - ( دوماه نامه 1399 ) برگشت به فهرست نسخه ها
مجله علمی پژوهشی فیض ::: دانشگاه علوم پزشکی کاشان KAUMS Journal ( FEYZ )
Persian site map - English site map - Created in 0.06 seconds with 32 queries by YEKTAWEB 4140