[Home ] [Archive]   [ فارسی ]  
:: Main :: About :: Current Issue :: Archive :: Search :: Submit :: Contact ::
Main Menu
Home::
Journal Information::
Indexing Sources::
Guide for Authors::
Online Submission::
Ethics::
Articles archive::
For Reviewers::
Contact us::
AI::
::
Basic and Clinical Biochemistry and Nutrition
..
DOAJ
..
CINAHL
..
EBSCO
..
IMEMR
..
ISC
..
Search in website

Advanced Search
..
Receive site information
Enter your Email in the following box to receive the site news and information.
..
enamad
..
:: Volume 24, Issue 2 (Bimonthly 2020) ::
Feyz Med Sci J 2020, 24(2): 219-226 Back to browse issues page
Evaluation of common mutations in β-thalassemia patients in Iranian populations using SNaPshot method
Sepideh Mehrzad , Zahra Keshtmand *
Department of Biology, Central Tehran Branch, Islamic Azad University, Tehran, I.R. Iran. , zkeshtmand2001@gmail.com
Abstract:   (2173 Views)
Background: Beta-thalassemia, with over 2 million carriers of β-thalassemia, is one of the most common genetic diseases in Iran. Identification of beta-globin gene mutations is necessary for a specific diagnostic and management program, such as prepartum diagnosis of β-thalassemia. This study aimed to investigate common mutations in β-thalassemia patients in Iranian populations using the SNaPshot method.
Material and Methods: In this descriptive study, 10 cc venous blood sample with EDTA were collected from 20 patients of medical genetics laboratory in Tehran and Ahvaz who were identified in the marriage-screening plan and after obtaining written consent and completing the questionnaire. Then, DNA was extracted by boiling method and SNaPshot method was used to determine mutations. Finally, data were analyzed with geen maper software.
Result: In this study, frequency of common beta-thalassemia mutations showed that IVS II-1/30% was the most common mutation of Fsc8-9 (20%), Fsc36-37 (15%), IVS I -5 (10%) and IVS II mutations (5%).
Conclusion: The results of the study indicate that the difference in prevalence between the present study and other studies could be due to the scattered statistical population and fewer samples taken because this study focuses more on the efficacy of SNaPshot technique in diagnosis.
Keywords: Thalassemia, SNaPshot, Beta-globin gene
Full-Text [PDF 456 kb]   (873 Downloads)    
Type of Study: Research | Subject: medicine, paraclinic
Received: 2019/07/15 | Revised: 2020/07/11 | Accepted: 2020/05/5 | Published: 2020/04/29
References
1. Cappellini MD, Motta I. New therapeutic targets in transfusion-dependent and-independent thalassemia. Hematology Am Soc Hematol Educ Program 2017; 2017(1): 278-83.
2. Birgens H, Ljung R. The thalassaemia syndromes. Scand J Clin Lab Invest 2007; 67(1): 11-26.
3. Verma IC, Kleanthous M, Saxena R, Fucharoen S, Winichagoon P, Raizuddin S, et al. Multicenter study of the molecular basis of thalassemia intermedia in different ethnic populations. Inter J Hemo Res 2007; 31(4): 439-52.
4. Cousens NE, Gaff CL, Metcalfe SA, Delatycki MB. Carrier screening for beta-thalassaemia: a review of International practice. Eur J Hum Genet 2010; 18(10): 1077-83
5. Chinchang W, Viprakasit V, Pung-Amritt P, Tanphaichitr VS, Yenchitsomanus PT.Molecular analysis of unknown β-globin gene mutations using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) technique and its application in Thai families with β-thalassemias and β-globin variants. Clin Biochem 2005; 38(11): 987-96.
6. Chanpeng P, Svasti S, Paiboonsukwong K, Smith DR, Leecharoenkiat K. Platelet proteome reveals specific proteins associated with platelet activation and the hypercoagulable state in β-thalassmia/HbE patients. Sci Rep 2019; 9(1): 1-11.
7. Pooladi N, Hosseinpour Feizi MA, Haghi M, Azarfam P, Hosseinpour Feizi A. Analysis of beta thalassemia mutations using the single strand conformation polymorphism (SSCP) technique. J Kurdistan Univ Med Sc 2010; 15(3): 13-9. [in Persian]
8. Najmabadi H, Pourfathollah AA, Neishabury M, Sahebjam F, Krugluger W, Oberkanins C. Rare and unexpected mutations among Iranian beta-thalassemia patients and prenatal samples discovered by reverse-hybridization and DNA sequencing. Inter J Hemo Res 2002; 87(10): 1113-14.
9. Newton C, Graham A, Heptinstall L, Powell S, Summers C, Kalsheker N, et al. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res 1989; 17(7): 2503-16.
10. Budowle B, Van Daal AJB. Forensically relevant SNP classes. Biotechniques 2008; 44(5): 603-10.
11. Noveski P, Trivodalieva S, Efremov G, Plaseska-Karanfilska DJBJoMG. Y chromosome single nucleotide polymorphisms typing by SNaPshot minisequencing. BJMG 2010; 13(1): 9-16.
12. Madjunkova S, Volk M, Peterlin B, Plaseska-Karanfilska DJGt, biomarkers m. Detection of thrombophilic mutations related to spontaneous abortions by a multiplex SNaPshot method. Genet Test Mol Biomarkers 2012; 16(4): 259-64.
13. Galehdari H, Salehi B, Pedram M, M Oraki Kohshour. High prevalence of rare mutations in the Beta globin gene in an ethnic group in iran. Iran Red Cres Med J 2011; 13(5): 356.
14. Biljana A, Georgi I, Dijana PK, Lyubomira C .Efficient Detection of Mediterranean β-Thalassemia Mutations by Multiplex Single-Nucleotide Primer Extension PLoS One 2012; 7(10): e48167.
15. Boonchai B, Chalinee M, Chanchai T. Molecular analysis of beta-globin gene mutations among Thai beta-thalassemia children: results from a single center study. Appl Clin Genet 2014; 7: 253–58.
16. Verma IC, Saxena R, Thomas E, Jain PK. Regional distribution of β-thalassemia mutations in India. Hum Genet 1997; 100(1): 109-13.
17. Rizo-de-la-Torre LC, Ibarra B, Sánchez-López JY, Magaña-Torres MT, Rentería-López VM, Perea-Díaz FJ Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients. Int J Lab Hematol 2017; 39(5): 539-45.
18. Kelkar AJ, Moses A. Thalassemia intermedia phenotype resulting from rare combination of c.46delT [Codon15 (-T)] mutation of beta globin gene and HPFH3.Clin Case Rep 2017; 5(7): 1107-10.
19. Miri-Moghaddam E, Zadeh-Vakili A, Rouhani Z, Naderi M, Eshghi P, Khazaei Feizabad A. Molecular basis and prenatal diagnosis of β-thalassemia among Balouch population in Iran. Prenat Diagn 2011; 31(8): 788-91.
20. Ozkinay F, Onay H, Karaca E, Arslan E, Erturk B, Ece Solmaz A, et al. Molecular basis of β-thalassemia in the population of the Aegean region of Turkey: Identification of a novel deletion mutation. Inter J Hemo Res 2015; 39(4): 230-34.
21. Aristizabal A, Merino S, Catediano E, Sasieta M, Aragües P, Navajas A. Clinical consequences of alpha-thalassemia in the Basque Country, Spain. Impact of neonatal screening. Anales de Pediatría (English Edition) 2015; 83(2): 85-8.
22. Hosseinpour Feizi MA, Hosseinpour Feizi AA, Pouladi N, Haghi M, Azarfam PJH. Molecular spectrum of β-thalassemia mutations in Northwestern Iran. Inter J Hemo Res 2008; 32(3): 255-61.
23. Mohammad Asl J, Samarbafzadeh AR, Mak Vandi M, Zandian KHM, Pedram M. A report on prevalence of β thalassemia gene mutations in thalassemia patients from khuzestan province. J Birjand Univ Med Sc 2008; 6(4): 398-03. [in Persian]
24. Nejat M, Rabbani B. An overview of mutation detection methods in genetic disorders. Iran J Pediatr 2013; 23(4): 375-88.
25. Nikuei P, Hadavi V, Rajaei M, Saberi M, Hajizade F, Najmabadi HJH. Prenatal diagnosis for β-thalassemia major in the Iranian Province of Hormozgan. Iran J Ped Hematol Oncol 2008; 32(6): 539-45.
26. Rahimi Z, Muniz A, Parsian A. Detection of responsible mutations for beta thalassemia in the Kermanshah Province of Iran using PCR-based techniques. Mol Biol Rep 2010; 37(1): 149-54.
27. Sharifi A, Aminzadeh M, Pourmoghaddam Z, N Mahdieh. The frequency of common beta-thalassemia mutations among couples referred to health centers of Ilam during a five years period. J Ilam Univ Med Sc 2014; 22(2): 17-23. [in Persian]
Send email to the article author

Add your comments about this article
Your username or Email:

CAPTCHA


XML   Persian Abstract   Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Mehrzad S, Keshtmand Z. Evaluation of common mutations in β-thalassemia patients in Iranian populations using SNaPshot method. Feyz Med Sci J 2020; 24 (2) :219-226
URL: http://feyz.kaums.ac.ir/article-1-3927-en.html


Creative Commons License
This open access journal is licensed under a Creative Commons Attribution-NonCommercial ۴.۰ International License. CC BY-NC ۴. Design and publishing by Kashan University of Medical Sciences.
Copyright ۲۰۲۳© Feyz Medical Sciences Journal. All rights reserved.
Volume 24, Issue 2 (Bimonthly 2020) Back to browse issues page
مجله علوم پزشکی فیض Feyz Medical Sciences Journal
Persian site map - English site map - Created in 0.13 seconds with 46 queries by YEKTAWEB 4704